Tüm virüslere karşı direnç mi istiyorsun: DNA alfabeni değiştir!

IMG-7203İki yıl önce, Harvard Üniversitesinde gizli yapılan bir toplantı basına sızdırıldı. Genom yazma projesi (GP-write veya diğer adı ile HGP-write) adı verilen bir proje için yapılan bu toplantıda Harvard ve diğer üniversitelerden bilim insanları “tüm bir insan genomunun yapay olarak sentezi“ni tartıştılar.

Peki bu neye yarayacaktı?

İnsan genomunu (yani 46 kromozomumuzdaki bilgiyi) yeniden yazma mümkün olsa, Alzheimer’den tutun kansere kadar hemen tüm insan hastalıklarına sebep olan bozuk genler düzeltilebilir ve böylece “süper insan” yaratılabilirdi.! Bu teknikle dünyaya gelen “dizayn edilmiş bebekler” her türlü hastalığa dirençli olabileceklerdi.

Peki bu nasıl mümkün olacaktı?

Bilgisayar ekranındaki yazıdan resme nasıl ki herşey “binary kod” dediğimiz sıfır ve birlerden (1111000001010100010 gibi) oluşuyorsa, genomomuz yani DNA da 4 harfle oluşturulmuş şifrelerden oluşuyor. Yani tanrının klavyesinde 4 tuş varmış ve üzerinde (A: adenin, G: guanin, C: sitozin ve T: timin) yazıyormuş. Tanrı, bakteriden, bitkiye, insana, file kısaca tüm canlıları aynı genetik kodla yazmış… Fakat, bunu yaparken yer yer “typo” hataları, yani “yazım hataları” da yapmış. Dolayısı ile, genlerimizdeki bu küçük yazılım hataları bizi bir ton hastalığa da yatkın hale getirmiş (kanser, şeker hastalığı, Alzheimer, Parkinson, kalp-damar hastalıkları,viral ve bakteriyel enfeksiyonlar, say sayabildiğin kadar…).

İnsan ve tabi tüm canlılarda DNA’daki genetik şifre RNA üzerinden kodlanıyor. RNA’lar DNA’nın tersine oldukça farklı çeşitte bulunuyor. Kimisi protein sentezine ön ayak oluyor ki, bunlara kodlama yapan RNA’lar (mRNAlar) deniyor, kimisi de diğer yapısal (örn. ribozomların yapısına giren rRNA’lar), işlevsel (örn. amino asitleri kendilerine has enzimlerle birlikte taşıyarak ribozoma getiren tRNA’lar) ve henüz yeni yeni keşfettiğimiz ve dolayısı ile şlevlerini tam bilmediğimiz RNA’lar (miRNA’lar, siRNA’lar, halkasal RNA’lar, lncRNA’lar, vs..).

RNA’ların çeşitleri ve muhtemel işlevleri konusundaki bir yazım: RNA: Önemsiz bir şeymi? Herşey mi?

Proteinlere deşifre olan RNA’lar (yani mRNA’lar) üzerinde 3 harflik diziler olan “kodonlar”, amino asitlere tercüme oluyor. Proteinler 20 çeşit amino asitten oluşuyor. Dolayısı ile her bir amino asit için en az 1 adet kodon olmak zorunda. Ancak, DNA ve RNA 4 harften oluştuğundan, 64 adet potansiyel üçlü kodon var (4x4x4). Dolayısı ile bazı amino asitler için birden fazla kodon var. Ancak, bu kodonların biri “esas” diğerleri ise “harcanabilir” ya da “gereksiz” veya “yedek” kodonlar.  Birçok virüs bu “yedek” kodonları hedef alarak bizi hastalandırıyor. Hastalıklarımızın çoğu da bu ikincil derecede önemli yedek kodonlarda olan değişiklikler (mutasyonlar) sonucu ortaya çıkıyor.

Başlıktaki konu, yani virüslere karşı bağışık (dirençli) olmak için, bilim insanları “redundant” dedikleri bu “yedek” kodonları “esas” kodonlara çevirecek gen düzeltmeleri yapmak istiyor. Böylece, DNA düzeyinde yapılan yapay dizi değişikliği (ya da yeniden sentez) ile sadece “esas” kodonlar kullanılacak. Bunun sonucu, vücuda (yani hücreye) girip asılları yanında “yedek” kodonları kullanarak kendi proteinlerini üretmeye çalışacak olan virüsler kendi kendilerini çoğaltamaz.

Bu projenin temeli Harvard Üniversitesi, Tıp Fakültesinden George Church’ın laboratuvarındaki çalışmalara dayanıyor. Church ve arkadaşları, yaygın bir bakteri olan Escherichia coli genomunda bir amino asiti kodlayan 321 “yedek” kodonu “esas” kodonla değiştirdiğinde, bakterinin  bakteriyofaj T7 virüsüne karşı dirençli hale geldiğini gösterdi.

genetic-medicine-collection

Aynı grup, 2016 yılında daha da ileri giderek 7 amino asite ait tüm “yedek” kodonları (62,214 adet) genomdan sildi. Sonuç: birçok virüse dirençli süper E. coli. Yapılan hesaplara göre, insan genomunda bulunan yaklaşık 20000 gende bu şekildeki yaklaşık 400,000 “yedek” kodunu asılları ile değiştirirsek insanlar virüslere tamamen dirençli (virüs geçirmez!) hale gelebilirler.

crispr-gene-editingEn başta bahsettiğimiz genomu yapay olarak yeniden sentezlemek gibi meşakkatli bir çabaya girmek yerine, CRISPR-Cas teknolojisi gibi yeni genom düzeltme (edit etme) teknolojileri ile hali hazırdaki genomlar bu şekilde hastalık ve virüslere karşı düzeltilebilir. Çünkü, 10 DNA harfinin sentezi yaklaşık 1 dolara mal olduğundan, bir insanın tüm haploit genomunun sentezi 30 milyon dolara mal olacak. Bir kerede en fazla 200 harf yazabildiğimiz için, yazılan bu parçaların birleşmesi vs. oldukça emek ve zaman isteyen bir durum.

CRISPR-Cas ile ilgili yazılar için buraya, buraya, burayaburaya ve buraya tıklayınız.

Dolayısı ile bugünlerde bir araya gelen ve yaklaşık 200 bilim insanından oluşan aynı grup, baştaki tüm genom sentezi projesinin boyutunu ve şeklini küçültmüş görünüyor. Genomu yeniden sentez yerine, tüm genomdaki “yedek” kodonları (400 bin kadar) “asılları” ile değiştirerek virüslere karşı dirençli insan hücresi (ve belki de ileride yumurta ve spermde bunu yaparak birey) oluşturmak. Bunun 10 yıl kadar bir sürede mümkün olacağı hesaplanıyor.

g-church
George Church’la Harvard medical School’daki bir sunumdan sonra… George Church genom dizileme çalışmalarında bir dünya lideri ve İnsan Genom Projesinde öncülerinden. İki metreye yaklaşan boyu ve iri cüssesinin yanında cüce gibi kalıyorum!!!

Hücreler ayrıca kansere karşı da yeniden kodlanabilir. Genomdaki en kararsız ve yüksek mutasyon oranına sahip iki harf CG’dir (yanyana bulunduklarında). Bu mutasyonlar bazen kanseri tetikler. Birçok amino asit “yedek” kodonu CG içerir. Bu kodonlar asılları ile değiştirilirse, hücreler hala aynı doğru amino asiti kullanır ancak, ancak tümörlerin ortaya çıka olasılığı oldukça azalır.

Değiştirilerek faydalanılan kaynaklar: STAT, JAMA, C&EN, The Atalantic, Science, NatureGP-write website

genome-write

Science Magazine
İleri derecede yeniden yazılmış genomu olan “ultragüvenli” hücrelerin bazı özellikleri (Science‘tan).

Konuya yabancı olanlar için başlıktaki konunun anlaşılması için biraz genel bilgiye ne dersiniz?..

DNA oldukça tekdüze yani “monoton” bir molekül. Tek işi üzerinde şifrelenmiş bilgi taşıması. O şifre deşifre edilmedikçe bir işe yaramıyor. Bunu şuna benzetebiliriz:  Elinizde kalın (6 milyar harften oluşan) bir kitap (46 kromozomdaki DNA) var ve kelimeler arasında ne yazık ki boşluk yok. Dolayısı ile bu paragraf şöyle görünecekti:

dnaoldukçatekdüzeyanimonotonbirmolekültekişiüzerindeşifrelenmişbilgitaşımasıoşifredeşi

freedilmedikçebirişeyaramıyorbunuşunabenzetebilirizelinizdekalınaltımilyarharftenoluşan

irkitapkırkaltıkromozomdakidnavarvekelimelerarasındaneyazıkkiboşlukyokdolayısıilebup

aragrafşöylegörünecekti

Bir şey anladınız mı? ben anlamadım! Tek fark, DNA’da 29 harf değil 4 harf kullanılıyor!!!

Dolayısı ile DNA’ya baktığımızda bizde çok da bir fikir oluşturmayan GCCCTTTTTGGGGAAAAATTTTTTTTCCGA harflerini görürüz. Peki bütün bir canlıyı yapan bilgi nasıl oluyor da bu harf dizilerinde saklı? Bilgisayardaki tüm bilgi nasıl ki “bir” ve “sıfır”larda saklı ise, DNA’da da aynı durum var… Bu şifreyi çözecek “programlar” var.

Esasen DNA’daki bilgiyi (kodu) çözen iki program var: çeviri (dekodlama) ve ifade.

Dekodlama ile DNA molekülü, RNA molekülüne çevriliyor. RNA, bir harfi hariç DNA ile aynı harfleri kullanıyor. Her nasılsa, DNA’daki T yerine RNA’da U (urasil) kullanılıyor. Dolayısı ile işlemin adı “yeniden kodlama”. Çünkü RNA’lara da bakarsanız genel olarak AGCU harflerinden oluştuğunu görürsünüz. Dolayısı ile bu harflerin dizilerinin de ne anlama geldiğini bilemezsiniz…

RNA’daki şifre nasıl çözülüyor. Bunu açıklamadan önce şunu söylememiz gerekiyor. Monoton DNA’ya göre RNA’lar oldukça farklı yapı ve işlevlerde bulunabiliyor. Ders kitaplarında esas olarak 3 çeşit RNA’dan (mRNA, rRNA, tRNA) yoğun olarak bahsedilse de, son yıllarda onlarca çeşit RNA (miRNAlar, siRNAlar, lncRNAlar, halkasal RNAlar, vs) keşfedildi ve çoğunun ne işe yaradığı ise tam bir muamma…

chromosomeŞifre çözmeye dönersek… Bu işi “ribozom” yapıyor. RNA ve proteinlerden oluşan bu yapılar tüm canlıların da ortak yapısı (hücre zarı ve DNA gibi). Ribozomlara bağlanan mRNA’lar burada deşifre edilir ve  yapısal ve işlevsel fonksiyonları olan olan proteinler yapılır. Yani, DNA’daki şifre RNA üzerinden proteinlere deşifre oluyor. Proteinlerde tüm yapısal ve görsel özelliklerimizi (fenotip) belirliyor. Yani genotip (DNA)’ten fenotipe (protein) bir bilgi akışı söz konusu… Tüm bu akışa “genetik kod” deniyor.

chromosome-nucl
Taramalı elektron mikroskobu ile görselleştirilen insan kromozomları ve çekirdeği

Genetik kodlama DNA üzerindeki bilgi RNA’ya transfer ediliyor. RNA (mRNA) üzerindeki bilgi 3 harfli kodonlarda saklı ve bu sırrı da ribozom çözüyor. Ribozom, mRNA’ların üzerindeki 3 harfin (kodon) sığacağı özel bir alana sahip. Buraya gelen ve üzerinde özel bir amino asidi taşıyan taşıyıcı RNA’lar (tRNA) üzerindeki 3 harfle (anti-kodon) kodona bağlanır. Enzimatik bir mekanizma ile taşınan bu amino asitler birbirine kovalent bir bağ (peptid bağı) ile bağlanır. Böylece, uzun bir polipetid zinciri yapılır ve bittikten sonra ribozomdan salınarak uygun yapı ve işlevi kazanacak şekilde katlanır.

DNA molekülü ne kadar uzun olursa olsun (örn, en uzun DNA molekülü 1. kromozomumuzda, en kısası da 22. kromozomda bulunmakta), 4 kimyasal molekülden (harf) oluşmakta. Esasen, en küçük kromozom, dolayısı ile en kısa DNA molekülü Y kromozomunda bulunmakta ise de, bu kromozom tüm insan (kadınlarda) veya hayvanlarda bulunmaz. Bu harflere çekirdek maddesi anlamına gelen “nükleotid” ismi verilir ve her birinde birer fosfat grubu, deoksiriboz adı verilen 5 karbonlu bir şeker molekülü ve her birinin kendine has tek (C ve T) veya çift halka (A ve G) içeren bazı bulunur.

DNA, kromozom ve genomlarla ilgili bir yazım: Genler Kaderimizmi?


Tüm virüslere karşı direnç mi istiyorsun: DNA alfabeni değiştir!” için bir yanıt

Bir Cevap Yazın

Aşağıya bilgilerinizi girin veya oturum açmak için bir simgeye tıklayın:

WordPress.com Logosu

WordPress.com hesabınızı kullanarak yorum yapıyorsunuz. Çıkış  Yap /  Değiştir )

Twitter resmi

Twitter hesabınızı kullanarak yorum yapıyorsunuz. Çıkış  Yap /  Değiştir )

Facebook fotoğrafı

Facebook hesabınızı kullanarak yorum yapıyorsunuz. Çıkış  Yap /  Değiştir )

Connecting to %s